Recombinant E. coli LexA
Cat.No. : | lexA-131E |
Product Overview : | The product is over-produced as a recombinant protein, and highly purified by several steps of chromatography. A single band is observed by SDS-PAGE at 23 kD. |
- Specification
- Gene Information
- Related Products
- Download
Description : | E. coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence(TACTGTATATATATACAGTA). LexA"s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the SOS regulon is induced, and DNA repair ability and mutagenic activity in the cells are enhanced. |
Species : | E. coli |
Form : | 50% glycerol, 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 5 mM mercaptoethanol |
Purity : | Over 90% by SDS-PAGE (CBB staining) |
Applications : | 1) Studies on the mechanism of E. coli SOS response.2) Used as an antigen for positive control in Western blotting to confirm that the Bait construct is expressed stably in the nucleus as protein of the expected size in the yeast two-hybrid method using the lexA gene. |
Storage : | Shipped at 4℃ or -20℃, and store at -80℃ for long period. |
Concentration : | 0.8 mg/ml as measured by BCA method |
Products Types
◆ Recombinant Protein | ||
lexA-4230E | Recombinant Escherichia coli lexA protein, His-SUMO-tagged | +Inquiry |
LEXA-0110B | Recombinant Bacillus subtilis LEXA protein, His-tagged | +Inquiry |
For Research Use Only. Not intended for any clinical use. No products from Creative BioMart may be resold, modified for resale or used to manufacture commercial products without prior written approval from Creative BioMart.
Inquiry
- Q&As
- Reviews
Q&As (0)
Ask a questionAsk a Question for All lexA Products
Required fields are marked with *
My Review for All lexA Products
Required fields are marked with *
0
Inquiry Basket