Recombinant Human IGF2 Protein, GST-tagged
Cat.No. : | IGF2-01H |
Product Overview : | Recombinant Human IGF2 Protein with GST tag was expressed in E. coli. |
- Specification
- Gene Information
- Related Products
Description : | This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
Source : | E. coli |
Species : | Human |
Tag : | GST |
AA Sequence : | CTGTGCGGCGGGGAGCTGGTGGACA CCCTCCAGTTCGTCTGTGGGGACCG CGGCTTCTACTTCAGCAGGCCCGCA AGCCGTGTGAGCCGTCGCAGCCGTG GCATCGTTGAGGAGTGCTGTTTCCG CAGCTGTGACCTGGCCCTCCTGGAG ACGTACTGTGCTACCCCCGCCAAGT CCGAG |
Purity : | > 85 % |
Gene Name : | IGF2 insulin like growth factor 2 [ Homo sapiens (human) ] |
Official Symbol : | IGF2 |
Synonyms : | IGF2; insulin like growth factor 2; GRDF; SRS3; IGF-II; PP9974; C11orf43; insulin-like growth factor II; T3M-11-derived growth factor; insulin-like growth factor 2 (somatomedin A); insulin-like growth factor type 2; preptin |
Gene ID : | 3481 |
mRNA Refseq : | NM_000612 |
Protein Refseq : | NP_000603 |
MIM : | 147470 |
UniProt ID : | P01344 |
Products Types
◆ Recombinant Protein | ||
Igf2-44M | Active Recombinant Mouse Igf2 Protein (Ala25-Glu91), N-His tagged, Animal-free, Carrier-free | +Inquiry |
IGF2-054H | Recombinant Human IGF2 Protein | +Inquiry |
Igf2-1224M | Active Recombinant Mouse Igf2 Protein | +Inquiry |
IGF2-5431H | Recombinant Human Insulin-Like Growth Factor 2 (somatomedin A) | +Inquiry |
IGF2-129H | Recombinant Active Human IGF2 Protein, His-tagged(N-ter) | +Inquiry |
◆ Native Protein | ||
IGF2-621H | Native Human Insulin-Like Growth Factor 2 (somatomedin A) | +Inquiry |
IGF2-29116TH | Native Human IGF2 | +Inquiry |
◆ Lysates | ||
IGF2-5266HCL | Recombinant Human IGF2 293 Cell Lysate | +Inquiry |
Related Gene
For Research Use Only. Not intended for any clinical use. No products from Creative BioMart may be resold, modified for resale or used to manufacture commercial products without prior written approval from Creative BioMart.
Inquiry
0
Inquiry Basket