Recombinant Mononucleosomes, Hemi-methylated 199x601 DNA
Cat.No. : | NUC-054 |
Product Overview : | Mononucleosomes assembled from recombinant histones expressed in E. coli. |
- Specification
- Gene Information
- Related Products
- Download
Description : | Mononucleosomes assembled from recombinant histones expressed in E. coli (two each of histones H2A, H2B, H3 and H4; accession numbers: H2A-P06897; H2B-P02281; H3-Q92133; H4-P62799) wrapped by 199 base pairs of DNA containing the 601 positioning sequence DNA. The the 199 bp DNA sequence contains a 147 base-pair 601 nucleosome positioning sequence. The 601 sequence is flanked by a hemi-methylated 26 bp sequence as shown in application notes. |
Source : | E. coli |
Tag : | N/A |
Form : | Mononucleosomes, Recombinant, 199x601 DNA (50 µg DNA + protein, 24.3 µg protein weight) in 10 mM Tris pH 7.5, 25 mM NaCl, 1 mM EDTA, 2 mM EDTA, 20% glycerol. |
Molecular Mass : | 231,482.74 Da |
Applications : | DNA sequence with methylation sites in RED 5'-GGACCCTATACGCGGCCGCCGAATTCCTGGAGAATCCCGGTCTGCAGGCCGCTCAATTGGTCGTAGACAGCTCTACGTGGCGAATTTGCGTGCATGCGCCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGGATCCGCCGGTCGCGAACAGCGACC-3' 3'-CCTGGGATATGCGCCGGCGGCTTAAGGACCTCTTAGGGCCAGACGTCCGGCGAGTTAACCAGCATCTGTCGAGATGCACCGCTTAAACGCACGTACGCGGACAGGGGGCGCAAAATTGGCGGTTCCCCTAATGAGGGATCAGAGGTCCGTGCACAGTCTATATATGTAGGACACCTAGGCGGCCAGCGCTTGTCGCTGG-5' |
Storage : | Stable for six months at -80°C from date of receipt. For best results, aliquot and avoid multiple freeze/thaws. |
Products Types
◆ Recombinant Protein | ||
NUC-064 | K-AcylStat Panel | +Inquiry |
NUC-021 | Recombinant Human Nucleosome, H3K27me2 dNuc, Biotinylated | +Inquiry |
NUC-049 | Recombinant Human Mononucleosomes (H3.3G34R), Biotinylated | +Inquiry |
NUC-012 | Recombinant Human Nucleosome, H3K4me1 dNuc, Biotinylated | +Inquiry |
NUC-009 | Recombinant Human Mononucleosomes (H3.1 N32) | +Inquiry |
For Research Use Only. Not intended for any clinical use. No products from Creative BioMart may be resold, modified for resale or used to manufacture commercial products without prior written approval from Creative BioMart.
Inquiry
- Q&As
- Reviews
Q&As (0)
Ask a questionAsk a Question for All NUC Products
Required fields are marked with *
My Review for All NUC Products
Required fields are marked with *
0
Inquiry Basket