Recombinant E. coli LexA


Home / Products / Recombinant Proteins / Recombinant E. coli LexA

Recombinant E. coli LexA

lexA Related Products

Price Inquiry

Welcome! For price inquiries, please feel free to contact us through the form below. We will get back to you as soon as possible.

Cat.No. : lexA-131E
Product Overview : The product is over-produced as a recombinant protein, and highly purified by several steps of chromatography. A single band is observed by SDS-PAGE at 23 kD.
Description : E. coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence(TACTGTATATATATACAGTA). LexA"s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the SOS regulon is induced, and DNA repair ability and mutagenic activity in the cells are enhanced.
Species : E. coli
Form : 50% glycerol, 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 5 mM mercaptoethanol
Purity : Over 90% by SDS-PAGE (CBB staining)
Applications : 1) Studies on the mechanism of E. coli SOS response.2) Used as an antigen for positive control in Western blotting to confirm that the Bait construct is expressed stably in the nucleus as protein of the expected size in the yeast two-hybrid method using the lexA gene.
Storage : Shipped at 4℃ or -20℃, and store at -80℃ for long period.
Concentration : 0.8 mg/ml as measured by BCA method
For Research Use Only. Not intended for any clinical use. No products from Creative BioMart may be resold, modified for resale or used to manufacture commercial products without prior written approval from Creative BioMart.

Online Inquiry

  • Note: There will be extra charge for optional service!

Optional Service: Optional requirements on this protein

Other Requirements:

Apply For A Coupon

$50 OFF Your First Purchase

Apply For a Coupon

Enter your email here to subscribe.

creative biomart inc.

Easy access to products and services you need from our library via powerful searching tools.

Follow Us

Copyright © 2021 Creative BioMart. All Rights Reserved. Terms and Conditions | Privacy Policy