Recombinant E. coli LexA

Cat.No. : lexA-131E
Product Overview : The product is over-produced as a recombinant protein, and highly purified by several steps of chromatography. A single band is observed by SDS-PAGE at 23 kD.
  • Specification
  • Gene Information
  • Related Products
  • Download
Species : E.coli
Tag : Non
Description : E. coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence(TACTGTATATATATACAGTA). LexA"s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the SOS regulon is induced, and DNA repair ability and mutagenic activity in the cells are enhanced.
Form : 50% glycerol, 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 5 mM mercaptoethanol
Purity : Over 90% by SDS-PAGE (CBB staining)
Applications : 1) Studies on the mechanism of E. coli SOS response.2) Used as an antigen for positive control in Western blotting to confirm that the Bait construct is expressed stably in the nucleus as protein of the expected size in the yeast two-hybrid method using the lexA gene.
Storage : Shipped at 4℃ or -20℃, and store at -80℃ for long period.
Concentration : 0.8 mg/ml as measured by BCA method

Not For Human Consumption!

Inquiry

  • Reviews (0)
  • Q&As (0)

Customer Reviews

Write a review

Ask a Question for All lexA Products

Required fields are marked with *

My Review for All lexA Products

Required fields are marked with *

0
cart-icon