Recombinant Human IGF2 Protein, GST-tagged
Cat.No. : | IGF2-01H |
Product Overview : | Recombinant Human IGF2 Protein with GST tag was expressed in E. coli. |
- Specification
- Gene Information
- Related Products
- Download
Species : | Human |
Source : | E.coli |
Tag : | GST |
Description : | This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
AA Sequence : | CTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCTGTGGGGACCGCGGCTTCTACTTCAGCAGGCCCGCAAGCCGTGTGAGCCGTCGCAGCCGTGGCATCGTTGAGGAGTGCTGTTTCCGCAGCTGTGACCTGGCCCTCCTGGAGACGTACTGTGCTACCCCCGCCAAGTCCGAG |
Purity : | > 85 % |
Gene Name | IGF2 insulin like growth factor 2 [ Homo sapiens (human) ] |
Official Symbol | IGF2 |
Synonyms | IGF2; insulin like growth factor 2; GRDF; SRS3; IGF-II; PP9974; C11orf43; insulin-like growth factor II; T3M-11-derived growth factor; insulin-like growth factor 2 (somatomedin A); insulin-like growth factor type 2; preptin |
Gene ID | 3481 |
mRNA Refseq | NM_000612 |
Protein Refseq | NP_000603 |
MIM | 147470 |
UniProt ID | P01344 |
◆ Recombinant Proteins | ||
IGF2-4461M | Recombinant Mouse IGF2 Protein, His (Fc)-Avi-tagged | +Inquiry |
Igf2-1224M | Active Recombinant Mouse Igf2 Protein | +Inquiry |
IGF2-1220H | Recombinant Human IGF2 Protein (30-180 aa), GST-tagged | +Inquiry |
Igf2-44M | Active Recombinant Mouse Igf2 Protein (Ala25-Glu91), N-His tagged, Animal-free, Carrier-free | +Inquiry |
IGF2-99R | Recombinant Rabbit IGF2 Protein | +Inquiry |
◆ Native Proteins | ||
IGF2-621H | Native Human Insulin-Like Growth Factor 2 (somatomedin A) | +Inquiry |
IGF2-29116TH | Native Human IGF2 | +Inquiry |
◆ Cell & Tissue Lysates | ||
IGF2-5266HCL | Recombinant Human IGF2 293 Cell Lysate | +Inquiry |
IGF2-5267HCL | Recombinant Human IGF2 293 Cell Lysate | +Inquiry |
Not For Human Consumption!
Inquiry
- Reviews (0)
- Q&As (0)
Ask a Question for All IGF2 Products
Required fields are marked with *
My Review for All IGF2 Products
Required fields are marked with *