Recombinant Human IGF2 Protein, GST-tagged

Cat.No. : IGF2-01H
Product Overview : Recombinant Human IGF2 Protein with GST tag was expressed in E. coli.
  • Specification
  • Gene Information
  • Related Products
  • Download
Species : Human
Source : E.coli
Tag : GST
Description : This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.
AA Sequence : CTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCTGTGGGGACCGCGGCTTCTACTTCAGCAGGCCCGCAAGCCGTGTGAGCCGTCGCAGCCGTGGCATCGTTGAGGAGTGCTGTTTCCGCAGCTGTGACCTGGCCCTCCTGGAGACGTACTGTGCTACCCCCGCCAAGTCCGAG
Purity : > 85 %
Gene Name IGF2 insulin like growth factor 2 [ Homo sapiens (human) ]
Official Symbol IGF2
Synonyms IGF2; insulin like growth factor 2; GRDF; SRS3; IGF-II; PP9974; C11orf43; insulin-like growth factor II; T3M-11-derived growth factor; insulin-like growth factor 2 (somatomedin A); insulin-like growth factor type 2; preptin
Gene ID 3481
mRNA Refseq NM_000612
Protein Refseq NP_000603
MIM 147470
UniProt ID P01344

Not For Human Consumption!

Inquiry

  • Reviews (0)
  • Q&As (0)

Customer Reviews

Write a review

Ask a Question for All IGF2 Products

Required fields are marked with *

My Review for All IGF2 Products

Required fields are marked with *

0
cart-icon
0
compare icon