Recombinant Mouse PTEN Protein

Cat.No. : PTEN-13631M
Product Overview : Recombinant Mouse PTEN full length or partial length protein was expressed.
  • Specification
  • Gene Information
  • Related Products
  • Citation
  • Download
Species : Mouse
Source : Mammalian Cells
Tag : His
Form : Liquid or lyophilized powder
Endotoxin : < 1.0 EU per μg of the protein as determined by the LAL method.
Purity : >80%
Notes : This item requires custom production and lead time is between 5-9 weeks. We can custom produce according to your specifications.
Storage : Store it at +4 ºC for short term. For long term storage, store it at -20 ºC~-80 ºC.
Storage Buffer : PBS buffer
Gene Name Pten phosphatase and tensin homolog [ Mus musculus ]
Official Symbol PTEN
Gene ID 19211
mRNA Refseq NM_008960.2
Protein Refseq NP_032986.1
MIM
UniProt ID O08586

Acylglycerol Kinase Maintains Metabolic State and Immune Responses of CD8 + T Cells.

Journal: Cell metabolism    PubMed ID: 31204281    Data: 2020/10/1

Authors: Zhilin Hu, Guojun Qu, Qiang Zou

Article Snippet:REAGENT or RESOURCE SOURCE IDENTIFIER Ovalbumin (323-339) Sigma Cat# O1641 PA Sigma Cat# P9511 3xFlag peptide Sigma Cat# F4799 Fixation/Permeabilization Concentrate Thermo Fisher Scientific Cat# 00-5123-43 Fixation/Permeabilization Diluent Thermo Fisher Scientific Cat# 00-5233-56 Permeabilization Buffer 10X Thermo Fisher Scientific Cat# 00-8333-56 Fix Buffer I BD Biosciences Cat# 557870 Perm Buffer III BD Biosciences Cat# 558050 Fixation/Permeabilization Solution BD Biosciences Cat# 554722 5-(and 6)-Carboxyfluorescein diacetate succinimidyl ester eBioscience Cat# 65-0850-85 Monensin eBioscience Cat# 65-4505-51 Recombinant Mouse PTEN Protein Creative BioMart Cat# PTEN-402M Critical Commercial Assays FITC Annexin V Apoptosis Detection Kit BD Biosciences Cat# 556547 PIP3 Mass ELLSA Kit Echelon Biosciences Cat# K-2500s XF Glycolytic stress test kit Agilent Technologies Cat# 103020-100 XF Cell Mito stress test kit Agilent Technologies Cat# 103015-100 MagniSort mouse na??ve CD4 T cell Enrichment kit Thermo Fisher Scientific Cat# 1993533 CD4 (L3T4) MicroBeads mouse Miltenyi Cat# 130-117-043 Na??ve CD8 T cell Isolation kit, mouse Miltenyi Cat# 130-096-543 CD8 (Ly-2) MicroBeads mouse Miltenyi Cat# 130-117-044 Plasma membrane protein extraction kit Abcam Cat# ab65400 Mouse LPA ELLSA KIT Shanghai Jianglai Biotech Cat# JL-F13961 Mouse PA ELLSA KIT Shanghai Jianglai Biotech Cat# JL-F13965 Deposited Data RNA-seq data This paper NCBI Trace and Short-Read Archive: PRJNA490796 Experimental Models: Cell Lines HEK-293T ATCC Cat# CRL-3216; RRID: CVCL_0063 Mouse B16-F10 melanoma cells ATCC Cat# CRL-6475, RRID: CVL_0159 Mouse B16-OVA melanoma cells Qiang Zou N/A Mouse MC38 colon cancer cells Kerafast RRID: CVCL_B288 Experimental Models: Organisms/Strains Cd4-Cre mice The Jackson Laboratory Cat# JAX:022071, RRID:IMSR_JAX:022071 Pten-floxed mice The Jackson Laboratory Cat# JAX:006440, RRID:IMSR_JAX:006440 Rag1–/– mice The Jackson Laboratory IMSR Cat# JAX:002216, RRID:IMSR_JAX:002216 OT-I The Jackson Laboratory Cat# 003831; RRID: IMSR_JAX:003831-UCD OT-II The Jackson Laboratory Cat# JAX:004194, RRID:IMSR_JAX:004194 B6.SJL mice The Jackson Laboratory Cat# 002014; RRID: IMSR_JAX:002014 Agk-floxed mice Shanghai Biomodel Organism Science & Technology Development Cat# NM-CKO-00026; AgkG126E/G126E mice Shanghai Bioray Laboratories Inc N/A Oligonucleotides Actin : CGTGAAAAGATGACCCAGATCA (forward) and CACAGCCTGGATGGCTA CGT (reverse) This paper N/A (Continued on next page) Cell Metabolism 30, 1–13.e1–e5, August 6, 2019 e2. REAGENT or RESOURCE SOURCE IDENTIFIER

Not For Human Consumption!

Inquiry

  • Reviews (0)
  • Q&As (0)

Customer Reviews

Write a review

Ask a Question for All PTEN Products

Required fields are marked with *

My Review for All PTEN Products

Required fields are marked with *

0
cart-icon