Recombinant Mouse PTEN Protein
| Cat.No. : | PTEN-13631M |
| Product Overview : | Recombinant Mouse PTEN full length or partial length protein was expressed. |
- Specification
- Gene Information
- Related Products
- Citation
- Download
| Species : | Mouse |
| Source : | Mammalian Cells |
| Tag : | His |
| Form : | Liquid or lyophilized powder |
| Endotoxin : | < 1.0 EU per μg of the protein as determined by the LAL method. |
| Purity : | >80% |
| Notes : | This item requires custom production and lead time is between 5-9 weeks. We can custom produce according to your specifications. |
| Storage : | Store it at +4 ºC for short term. For long term storage, store it at -20 ºC~-80 ºC. |
| Storage Buffer : | PBS buffer |
| Gene Name | Pten phosphatase and tensin homolog [ Mus musculus ] |
| Official Symbol | PTEN |
| Gene ID | 19211 |
| mRNA Refseq | NM_008960.2 |
| Protein Refseq | NP_032986.1 |
| MIM | |
| UniProt ID | O08586 |
| ◆ Recombinant Proteins | ||
| PTEN-1792H | Recombinant Human PTEN Protein, His (Fc)-Avi-tagged | +Inquiry |
| PTEN-31H | Recombinant Human PTEN Protein, His-tagged | +Inquiry |
| PTEN-3686R | Recombinant Rhesus monkey PTEN Protein, His-tagged | +Inquiry |
| PTEN-078H | Recombinant Human PTEN Protein, His-tagged | +Inquiry |
| PTEN-6057H | Recombinant Human PTEN Protein (Full Length, G124E), N-GST tagged | +Inquiry |
| ◆ Cell & Tissue Lysates | ||
| PTEN-2721HCL | Recombinant Human PTEN 293 Cell Lysate | +Inquiry |
Acylglycerol Kinase Maintains Metabolic State and Immune Responses of CD8 + T Cells.
Journal: Cell metabolism PubMed ID: 31204281 Data: 2020/10/1
Authors: Zhilin Hu, Guojun Qu, Qiang Zou
Article Snippet:REAGENT or RESOURCE SOURCE IDENTIFIER Ovalbumin (323-339) Sigma Cat# O1641 PA Sigma Cat# P9511 3xFlag peptide Sigma Cat# F4799 Fixation/Permeabilization Concentrate Thermo Fisher Scientific Cat# 00-5123-43 Fixation/Permeabilization Diluent Thermo Fisher Scientific Cat# 00-5233-56 Permeabilization Buffer 10X Thermo Fisher Scientific Cat# 00-8333-56 Fix Buffer I BD Biosciences Cat# 557870 Perm Buffer III BD Biosciences Cat# 558050 Fixation/Permeabilization Solution BD Biosciences Cat# 554722 5-(and 6)-Carboxyfluorescein diacetate succinimidyl ester eBioscience Cat# 65-0850-85 Monensin eBioscience Cat# 65-4505-51 Recombinant Mouse PTEN Protein Creative BioMart Cat# PTEN-402M Critical Commercial Assays FITC Annexin V Apoptosis Detection Kit BD Biosciences Cat# 556547 PIP3 Mass ELLSA Kit Echelon Biosciences Cat# K-2500s XF Glycolytic stress test kit Agilent Technologies Cat# 103020-100 XF Cell Mito stress test kit Agilent Technologies Cat# 103015-100 MagniSort mouse na??ve CD4 T cell Enrichment kit Thermo Fisher Scientific Cat# 1993533 CD4 (L3T4) MicroBeads mouse Miltenyi Cat# 130-117-043 Na??ve CD8 T cell Isolation kit, mouse Miltenyi Cat# 130-096-543 CD8 (Ly-2) MicroBeads mouse Miltenyi Cat# 130-117-044 Plasma membrane protein extraction kit Abcam Cat# ab65400 Mouse LPA ELLSA KIT Shanghai Jianglai Biotech Cat# JL-F13961 Mouse PA ELLSA KIT Shanghai Jianglai Biotech Cat# JL-F13965 Deposited Data RNA-seq data This paper NCBI Trace and Short-Read Archive: PRJNA490796 Experimental Models: Cell Lines HEK-293T ATCC Cat# CRL-3216; RRID: CVCL_0063 Mouse B16-F10 melanoma cells ATCC Cat# CRL-6475, RRID: CVL_0159 Mouse B16-OVA melanoma cells Qiang Zou N/A Mouse MC38 colon cancer cells Kerafast RRID: CVCL_B288 Experimental Models: Organisms/Strains Cd4-Cre mice The Jackson Laboratory Cat# JAX:022071, RRID:IMSR_JAX:022071 Pten-floxed mice The Jackson Laboratory Cat# JAX:006440, RRID:IMSR_JAX:006440 Rag1–/– mice The Jackson Laboratory IMSR Cat# JAX:002216, RRID:IMSR_JAX:002216 OT-I The Jackson Laboratory Cat# 003831; RRID: IMSR_JAX:003831-UCD OT-II The Jackson Laboratory Cat# JAX:004194, RRID:IMSR_JAX:004194 B6.SJL mice The Jackson Laboratory Cat# 002014; RRID: IMSR_JAX:002014 Agk-floxed mice Shanghai Biomodel Organism Science & Technology Development Cat# NM-CKO-00026; AgkG126E/G126E mice Shanghai Bioray Laboratories Inc N/A Oligonucleotides Actin : CGTGAAAAGATGACCCAGATCA (forward) and CACAGCCTGGATGGCTA CGT (reverse) This paper N/A (Continued on next page) Cell Metabolism 30, 1–13.e1–e5, August 6, 2019 e2. REAGENT or RESOURCE SOURCE IDENTIFIER
Not For Human Consumption!
Inquiry
- Reviews (0)
- Q&As (0)
Ask a Question for All PTEN Products
Required fields are marked with *
My Review for All PTEN Products
Required fields are marked with *




