Recombinant Human FXYD3 protein, His-SUMO-tagged

Cat.No. : FXYD3-4429H
Product Overview : Recombinant Human FXYD3 protein(Q14802)(21-38aa), fused to N-terminal His-SUMO tag, was expressed in E. coli
  • Specification
  • Gene Information
  • Related Products
  • Download
Species : Human
Source : E.coli
Tag : His&SUMO
Protein Length : 21-38aa
Form : If the delivery form is liquid, the default storage buffer is Tris/PBS-based buffer, 5%-50% glycerol.
If the delivery form is lyophilized powder, the buffer before lyophilization is Tris/PBS-based buffer, 6% Trehalose, pH 8.0.
Molecular Mass : 18.3 kDa
AA Sequence : AATGACCTAGAAGATAAAAACAGTCCTTTCTACTATGACTGGCACAGCCTCCAG
Purity : Greater than 85% as determined by SDS-PAGE.
Storage : Store at -20°C/-80°C upon receipt, aliquoting is necessary for mutiple use. Avoid repeated freeze-thaw cycles.
Reconstitution : Please reconstitute protein in deionized sterile water to a concentration of 0.1-1.0 mg/mL.We recommend to add 5-50% of glycerol (final concentration) and aliquot for long-term storage at -20°C/-80°C. Our default final concentration of glycerol is 50%.
Gene Name FXYD3 FXYD domain containing ion transport regulator 3 [ Homo sapiens ]
Official Symbol FXYD3
Synonyms FXYD3; FXYD domain containing ion transport regulator 3; FXYD domain containing ion transport regulator 3 , PLML; FXYD domain-containing ion transport regulator 3; MAT 8; phospholemman-like protein; mammary tumor 8 kDa protein; chloride conductance inducer protein Mat-8; MAT8; PLML; MGC111076;
Gene ID 5349
mRNA Refseq NM_001136007
Protein Refseq NP_001129479
MIM 604996
UniProt ID Q14802

Not For Human Consumption!

Inquiry

  • Reviews (0)
  • Q&As (0)

Customer Reviews

Write a review

Ask a Question for All FXYD3 Products

Required fields are marked with *

My Review for All FXYD3 Products

Required fields are marked with *

0

Inquiry Basket

cartIcon