Recombinant Human FXYD3 protein, His-SUMO-tagged
| Cat.No. : | FXYD3-4429H |
| Product Overview : | Recombinant Human FXYD3 protein(Q14802)(21-38aa), fused to N-terminal His-SUMO tag, was expressed in E. coli |
- Specification
- Gene Information
- Related Products
- Download
| Species : | Human |
| Source : | E.coli |
| Tag : | His&SUMO |
| Protein Length : | 21-38aa |
| Form : | If the delivery form is liquid, the default storage buffer is Tris/PBS-based buffer, 5%-50% glycerol. If the delivery form is lyophilized powder, the buffer before lyophilization is Tris/PBS-based buffer, 6% Trehalose, pH 8.0. |
| Molecular Mass : | 18.3 kDa |
| AA Sequence : | AATGACCTAGAAGATAAAAACAGTCCTTTCTACTATGACTGGCACAGCCTCCAG |
| Purity : | Greater than 85% as determined by SDS-PAGE. |
| Storage : | Store at -20°C/-80°C upon receipt, aliquoting is necessary for mutiple use. Avoid repeated freeze-thaw cycles. |
| Reconstitution : | Please reconstitute protein in deionized sterile water to a concentration of 0.1-1.0 mg/mL.We recommend to add 5-50% of glycerol (final concentration) and aliquot for long-term storage at -20°C/-80°C. Our default final concentration of glycerol is 50%. |
| Gene Name | FXYD3 FXYD domain containing ion transport regulator 3 [ Homo sapiens ] |
| Official Symbol | FXYD3 |
| Synonyms | FXYD3; FXYD domain containing ion transport regulator 3; FXYD domain containing ion transport regulator 3 , PLML; FXYD domain-containing ion transport regulator 3; MAT 8; phospholemman-like protein; mammary tumor 8 kDa protein; chloride conductance inducer protein Mat-8; MAT8; PLML; MGC111076; |
| Gene ID | 5349 |
| mRNA Refseq | NM_001136007 |
| Protein Refseq | NP_001129479 |
| MIM | 604996 |
| UniProt ID | Q14802 |
| ◆ Recombinant Proteins | ||
| Fxyd3-3114M | Recombinant Mouse Fxyd3 Protein, Myc/DDK-tagged | +Inquiry |
| FXYD3-1355H | Recombinant Human FXYD3, MYC&DDK-tagged | +Inquiry |
| FXYD3-4429H | Recombinant Human FXYD3 protein, His-SUMO-tagged | +Inquiry |
| FXYD3-1354H | Recombinant Human FXYD3, MYC&DDK-tagged | +Inquiry |
| FXYD3-172HF | Recombinant Full Length Human FXYD3 Protein | +Inquiry |
| ◆ Cell & Tissue Lysates | ||
| FXYD3-6101HCL | Recombinant Human FXYD3 293 Cell Lysate | +Inquiry |
| FXYD3-6100HCL | Recombinant Human FXYD3 293 Cell Lysate | +Inquiry |
Not For Human Consumption!
Inquiry
- Reviews (0)
- Q&As (0)
Ask a Question for All FXYD3 Products
Required fields are marked with *
My Review for All FXYD3 Products
Required fields are marked with *
