Recombinant Human FXYD3 protein, His-SUMO-tagged
Cat.No. : | FXYD3-4429H |
Product Overview : | Recombinant Human FXYD3 protein(Q14802)(21-38aa), fused to N-terminal His-SUMO tag, was expressed in E. coli |
- Specification
- Gene Information
- Related Products
Source : | E. coli |
Species : | Human |
Tag : | His-SUMO |
Form : | If the delivery form is liquid, the default storage buffer is Tris/PBS-based buffer, 5%-50% glycerol. If the delivery form is lyophilized powder, the buffer before lyophilization is Tris/PBS-based buffer, 6% Trehalose, pH 8.0. |
Molecular Mass : | 18.3 kDa |
Protein length : | 21-38aa |
AA Sequence : | AATGACCTAGAAGATAAAAACAGTC CTTTCTACTATGACTGGCACAGCCT CCAG |
Purity : | Greater than 85% as determined by SDS-PAGE. |
Storage : | Store at -20°C/-80°C upon receipt, aliquoting is necessary for mutiple use. Avoid repeated freeze-thaw cycles. |
Reconstitution : | Please reconstitute protein in deionized sterile water to a concentration of 0.1-1.0 mg/mL.We recommend to add 5-50% of glycerol (final concentration) and aliquot for long-term storage at -20°C/-80°C. Our default final concentration of glycerol is 50%. |
Gene Name : | FXYD3 FXYD domain containing ion transport regulator 3 [ Homo sapiens ] |
Official Symbol : | FXYD3 |
Synonyms : | FXYD3; FXYD domain containing ion transport regulator 3; FXYD domain containing ion transport regulator 3 , PLML; FXYD domain-containing ion transport regulator 3; MAT 8; phospholemman-like protein; mammary tumor 8 kDa protein; chloride conductance inducer protein Mat-8; MAT8; PLML; MGC111076; |
Gene ID : | 5349 |
mRNA Refseq : | NM_001136007 |
Protein Refseq : | NP_001129479 |
MIM : | 604996 |
UniProt ID : | Q14802 |
Products Types
◆ Recombinant Protein | ||
FXYD3-1355H | Recombinant Human FXYD3, MYC&DDK-tagged | +Inquiry |
FXYD3-4580H | Recombinant Human FXYD3 Protein, GST-tagged | +Inquiry |
Fxyd3-3114M | Recombinant Mouse Fxyd3 Protein, Myc/DDK-tagged | +Inquiry |
FXYD3-1352H | Recombinant Human FXYD3, His&GST-tagged | +Inquiry |
FXYD3-2078R | Recombinant Rat FXYD3 Protein, His (Fc)-Avi-tagged | +Inquiry |
◆ Lysates | ||
FXYD3-6101HCL | Recombinant Human FXYD3 293 Cell Lysate | +Inquiry |
FXYD3-6100HCL | Recombinant Human FXYD3 293 Cell Lysate | +Inquiry |
Related Gene
For Research Use Only. Not intended for any clinical use. No products from Creative BioMart may be resold, modified for resale or used to manufacture commercial products without prior written approval from Creative BioMart.
Inquiry
0
Inquiry Basket