Recombinant Human FXYD3 protein, His-SUMO-tagged

• Cat.No.: FXYD3-4429H
• Product Overview: Recombinant Human FXYD3 protein(Q14802)(21-38aa), fused to N-terminal His-SUMO tag, was expressed in E. coli

Specification

• Source: E. coli
• Species: Human
• Tag: His-SUMO
• Form: If the delivery form is liquid, the default storage buffer is Tris/PBS-based buffer, 5%-50% glycerol.
  If the delivery form is lyophilized powder, the buffer before lyophilization is Tris/PBS-based buffer, 6% Trehalose, pH 8.0.
• Molecular Mass: 18.3 kDa
• Protein length: 21-38aa
• AA Sequence: AATGACCTAGAAGATAAAAACAGTC CTTTCTACTATGACTGGCACAGCCT CCAG
• Purity: Greater than 85% as determined by SDS-PAGE.
• Storage: Store at -20°C/-80°C upon receipt, aliquoting is necessary for mutiple use. Avoid repeated freeze-thaw cycles.
• Reconstitution: Please reconstitute protein in deionized sterile water to a concentration of 0.1-1.0 mg/mL.We recommend to add 5-50% of glycerol (final concentration) and aliquot for long-term storage at -20°C/-80°C. Our default final concentration of glycerol is 50%.

Gene Information

• Gene Name: FXYD3 FXYD domain containing ion transport regulator 3 [ Homo sapiens ]
• Official Symbol: FXYD3
• Synonyms: FXYD3; FXYD domain containing ion transport regulator 3; FXYD domain containing ion transport regulator 3 , PLML; FXYD domain-containing ion transport regulator 3; MAT 8; phospholemman-like protein; mammary tumor 8 kDa protein; chloride conductance inducer protein Mat-8; MAT8; PLML; MGC111076
• Gene ID: 5349
• mRNA Refseq: NM_001136007
• Protein Refseq: NP_001129479
• MIM: 604996
• UniProt ID: Q14802