Recombinant Mononucleosomes, 199x601 DNA
| Cat.No. : | NUC-056 |
| Product Overview : | Mononucleosomes assembled from recombinant histones expressed in E. coli. |
- Specification
- Gene Information
- Related Products
- Download
| Source : | E.coli |
| Tag : | Non |
| Description : | Mononucleosomes assembled from recombinant histones expressed in E. coli (two each of histones H2A, H2B, H3 and H4; accession numbers: H2A-P06897; H2B-P02281; H3-Q92133; H4-P62799) wrapped by 199 base pairs of DNA containing the 601 positioning sequence DNA. The the 199 bp DNA sequence contains a 147 base-pair 601 nucleosome positioning sequence. The 601 sequence is flanked by a 26 bp sequence as shown in application notes. |
| Form : | Mononucleosomes, Recombinant, 199x601 DNA (50 µg DNA + protein, 24.3 µg protein weight) in 10 mM Tris pH 7.5, 25 mM NaCl, 1 mM EDTA, 2 mM EDTA, 20% glycerol. |
| Molecular Mass : | 231,289.05 Da |
| Applications : | 5'-GGACCCTATACGCGGCCGCCGAATTCCTGGAGAATCCCGGTCTGCAGGCCGCTCAATTGGTCGTAGACAGCTCTACGTGGCGAATTTGCGTGCATGCGCCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGGATCCGCCGGTCGCGAACAGCGACC-3' 3'-CCTGGGATATGCGCCGGCGGCTTAAGGACCTCTTAGGGCCAGACGTCCGGCGAGTTAACCAGCATCTGTCGAGATGCACCGCTTAAACGCACGTACGCGGACAGGGGGCGCAAAATTGGCGGTTCCCCTAATGAGGGATCAGAGGTCCGTGCACAGTCTATATATGTAGGACACCTAGGCGGCAGCGCTTGTCGCTGG-5' |
| Storage : | Stable for six months at -80°C from date of receipt. For best results, aliquot and avoid multiple freeze/thaws. |
| ◆ Recombinant Proteins | ||
| NUC-031 | Recombinant Human Nucleosome, H3K79me3 dNuc, Biotinylated | +Inquiry |
| NUC-063 | OncoStat Panel | +Inquiry |
| NUC-039 | Recombinant Human Nucleosome, H2AXS139phos dNuc, Biotinylated | +Inquiry |
| NUC-012 | Recombinant Human Nucleosome, H3K4me1 dNuc, Biotinylated | +Inquiry |
| NUC-002 | Recombinant Human Nucleosome, His-tagged, Biotinylated | +Inquiry |
Not For Human Consumption!
Inquiry
- Reviews (0)
- Q&As (0)
Ask a Question for All NUC Products
Required fields are marked with *
My Review for All NUC Products
Required fields are marked with *
