Recombinant Mononucleosomes, Symmetrically Methylated 199x601 DNA, Biotinylated

Cat.No. : NUC-057
Product Overview : Mononucleosomes assembled from recombinant histones expressed in E. coli.
  • Specification
  • Gene Information
  • Related Products
  • Download
Source : E.coli
Tag : Non
Description : Mononucleosomes assembled from recombinant histones expressed in E. coli (two each of histones H2A, H2B, H3 and H4; accession numbers: H2A-P06897; H2B-P02281; H3-Q92133; H4-P62799) wrapped by 199 base pairs of DNA containing the 601 positioning sequence DNA. The the 199 bp DNA sequence contains a 147 base-pair 601 nucleosome positioning sequence, identified by Lowary and Widom, which has high affinity for histone octamers and is useful for nucleosome assembly. The 601 sequence is flanked by a 26 bp sequence as shown in application notes and contains a 5' biotin-TEG group.
Form : Mononucleosomes, Recombinant, Symmetrically Methylated 199x601 DNA (50 µg DNA + protein, 24.3 µg protein weight) in 10 mM Tris pH 7.5, 25 mM NaCl, 1 mM EDTA, 2 mM EDTA, 20% glycerol.
Molecular Mass : 232,993.9 Da
Applications : DNA sequence with methylation sites in RED
5'-Biotin-TEGGGACCCTATACGCGGCCGCCGAATTCCTGGAGAATCCCGGTCTGCAGGCCGCTCAATTGGTCGTAGACAGCTCTACGTGGCGAATTTGCGTGCATGCGCCTGTCCCCCGCGTTTTAACCGCCA
AGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGGATCCGCCGGTCGCGAACAGCGACC-3'
3'CCTGGGATATGCGCCGGCGGCTTAAGGACCTCTTAGGGCCAGACGTCCGGCGAGTTAACCAGCATCTGTCGAGATGCACCGCTTAAACGCACGTACGCGGACAGGGGGCGCAAAATTGGCGGTTCCCCTAATGAGGGATCAGAGGTCCGTGCACAGTCTATATATGTAGGACACCTAGGCGGCCAGCGCTTGTCGCTGG-5'
Storage : Stable for six months at -80°C from date of receipt. For best results, aliquot and avoid multiple freeze/thaws.

Not For Human Consumption!

Inquiry

  • Reviews (0)
  • Q&As (0)

Customer Reviews

Write a review

Ask a Question for All NUC Products

Required fields are marked with *

My Review for All NUC Products

Required fields are marked with *

0
cart-icon