Recombinant Mononucleosomes, Symmetrically Methylated 199x601 DNA, Biotinylated

• Cat.No.: NUC-057
• Product Overview: Mononucleosomes assembled from recombinant histones expressed in E. coli.

Specification

• Description: Mononucleosomes assembled from recombinant histones expressed in E. coli (two each of histones H2A, H2B, H3 and H4; accession numbers: H2A-P06897; H2B-P02281; H3-Q92133; H4-P62799) wrapped by 199 base pairs of DNA containing the 601 positioning sequence DNA. The the 199 bp DNA sequence contains a 147 base-pair 601 nucleosome positioning sequence, identified by Lowary and Widom, which has high affinity for histone octamers and is useful for nucleosome assembly. The 601 sequence is flanked by a 26 bp sequence as shown in application notes and contains a 5' biotin-TEG group.
• Source: E. coli
• Tag: N/A
• Form: Mononucleosomes, Recombinant, Symmetrically Methylated 199x601 DNA (50 µg DNA + protein, 24.3 µg protein weight) in 10 mM Tris pH 7.5, 25 mM NaCl, 1 mM EDTA, 2 mM EDTA, 20% glycerol.
• Molecular Mass: 232,993.9 Da
• Applications: DNA sequence with methylation sites in RED
  5'-Biotin-TEGGGACCCTATACGCGGCCGCCGAATTCCTGGAGAATCCCGGTCTGCAGGCCGCTCAATTGGTCGTAGACAGCTCTACGTGGCGAATTTGCGTGCATGCGCCTGTCCCCCGCGTTTTAACCGCCA
  AGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGGATCCGCCGGTCGCGAACAGCGACC-3'
  3'CCTGGGATATGCGCCGGCGGCTTAAGGACCTCTTAGGGCCAGACGTCCGGCGAGTTAACCAGCATCTGTCGAGATGCACCGCTTAAACGCACGTACGCGGACAGGGGGCGCAAAATTGGCGGTTCCCCTAATGAGGGATCAGAGGTCCGTGCACAGTCTATATATGTAGGACACCTAGGCGGCCAGCGCTTGTCGCTGG-5'
• Storage: Stable for six months at -80°C from date of receipt. For best results, aliquot and avoid multiple freeze/thaws.