Remodeling Assay Substrate DNA ST601-GATC1
| Cat.No. : | NUC-061 |
- Specification
- Gene Information
- Related Products
- Download
| Description : | Remodeling Assay Substrate DNA ST601-GATC1 is a 217 base-pair double-stranded DNA fragment. This sequence includes the Lowary 601 nucleosome positioning sequence (see 18-0005) as well as a 3' acceptor sequence to accomodate the histone octamer subsequent to remodeling. ST601-GATC1 DNA has a restriction enzyme site embedded in the 601 sequence that is accessible after nucleosome remodeling. |
| Form : | 50 µg lyophilyzed ST601-GATC1 sequence DNA. |
| Applications : | Remodeling Assay Substrate DNA ST601-GATC0 is useful as a positive control for restriction enzyme accessibility nucleosome remodeling assays using the EpiDyne Remodeling Assay Substrate, as a DpnII restriction enzyme site is present within the 601 sequence. DNA Sequence: GAATTCATCAGAATCCCGGTGCCGAGGCCGATCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCGATGATGATGGATAGATGGATGATGGATGGATGGATGATGATGGATGAATAGATGGATGGATGAAGCTT |
| Storage : | Stable for 2 years at -20°C from date of receipt. After resuspending, aliquots should be stored at -80°C. |
Products Types
For Research Use Only. Not intended for any clinical use. No products from Creative BioMart may be resold, modified for resale or used to manufacture commercial products without prior written approval from Creative BioMart.
Inquiry
- Q&As
- Reviews
Ask a Question for All NUC Products
Required fields are marked with *
My Review for All NUC Products
Required fields are marked with *
0
Inquiry Basket
