Remodeling Assay Substrate DNA ST601-GATC1

Cat.No. : NUC-061
  • Specification
  • Gene Information
  • Related Products
  • Download
Tag : Non
Description : Remodeling Assay Substrate DNA ST601-GATC1 is a 217 base-pair double-stranded DNA fragment. This sequence includes the Lowary 601 nucleosome positioning sequence (see 18-0005) as well as a 3' acceptor sequence to accomodate the histone octamer subsequent to remodeling. ST601-GATC1 DNA has a restriction enzyme site embedded in the 601 sequence that is accessible after nucleosome remodeling.
Form : 50 µg lyophilyzed ST601-GATC1 sequence DNA.
Applications : Remodeling Assay Substrate DNA ST601-GATC0 is useful as a positive control for restriction enzyme accessibility nucleosome remodeling assays using the EpiDyne Remodeling Assay Substrate, as a DpnII restriction enzyme site is present within the 601 sequence.
DNA Sequence: GAATTCATCAGAATCCCGGTGCCGAGGCCGATCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCGATGATGATGGATAGATGGATGATGGATGGATGGATGATGATGGATGAATAGATGGATGGATGAAGCTT
Storage : Stable for 2 years at -20°C from date of receipt. After resuspending, aliquots should be stored at -80°C.

Not For Human Consumption!

Inquiry

  • Reviews (0)
  • Q&As (0)

Customer Reviews

Write a review

Ask a Question for All NUC Products

Required fields are marked with *

My Review for All NUC Products

Required fields are marked with *

0
cart-icon
0
compare icon