Remodeling Assay Substrate DNA ST601-GATC1

• Cat.No.: NUC-061

Specification

• Tag: Non
• Description: Remodeling Assay Substrate DNA ST601-GATC1 is a 217 base-pair double-stranded DNA fragment. This sequence includes the Lowary 601 nucleosome positioning sequence (see 18-0005) as well as a 3' acceptor sequence to accomodate the histone octamer subsequent to remodeling. ST601-GATC1 DNA has a restriction enzyme site embedded in the 601 sequence that is accessible after nucleosome remodeling.
• Form: 50 µg lyophilyzed ST601-GATC1 sequence DNA.
• Applications: Remodeling Assay Substrate DNA ST601-GATC0 is useful as a positive control for restriction enzyme accessibility nucleosome remodeling assays using the EpiDyne Remodeling Assay Substrate, as a DpnII restriction enzyme site is present within the 601 sequence.
  DNA Sequence: GAATTCATCAGAATCCCGGTGCCGAGGCCGATCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCGATGATGATGGATAGATGGATGATGGATGGATGGATGATGATGGATGAATAGATGGATGGATGAAGCTT
• Storage: Stable for 2 years at -20°C from date of receipt. After resuspending, aliquots should be stored at -80°C.