Remodeling Assay Substrate DNA ST601-GATC1
| Cat.No. : | NUC-061 |
- Specification
- Gene Information
- Related Products
- Download
| Tag : | Non |
| Description : | Remodeling Assay Substrate DNA ST601-GATC1 is a 217 base-pair double-stranded DNA fragment. This sequence includes the Lowary 601 nucleosome positioning sequence (see 18-0005) as well as a 3' acceptor sequence to accomodate the histone octamer subsequent to remodeling. ST601-GATC1 DNA has a restriction enzyme site embedded in the 601 sequence that is accessible after nucleosome remodeling. |
| Form : | 50 µg lyophilyzed ST601-GATC1 sequence DNA. |
| Applications : | Remodeling Assay Substrate DNA ST601-GATC0 is useful as a positive control for restriction enzyme accessibility nucleosome remodeling assays using the EpiDyne Remodeling Assay Substrate, as a DpnII restriction enzyme site is present within the 601 sequence. DNA Sequence: GAATTCATCAGAATCCCGGTGCCGAGGCCGATCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCGATGATGATGGATAGATGGATGATGGATGGATGGATGATGATGGATGAATAGATGGATGGATGAAGCTT |
| Storage : | Stable for 2 years at -20°C from date of receipt. After resuspending, aliquots should be stored at -80°C. |
Not For Human Consumption!
Inquiry
- Reviews (0)
- Q&As (0)
Ask a Question for All NUC Products
Required fields are marked with *
My Review for All NUC Products
Required fields are marked with *
